Plasmid Backbone

T0

 

rho-independent transcriptional terminator of phage lambda (103 bp).
DNA sequence:
SpeI – – – CTTGGACTCCTGTTGATAGATCCAGTAATGACCTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTTTA
TTGGTGAGAATCCAG – – – SanDI – – – SwaI

 

T1

 

rho-independent transcriptional terminator of the rrnB operon of E. coli (105 bp).
DNA sequence:

AscI – – -TCTAGGGCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGC
CTTTCGTTTTATTTGATGCC – – – PacI

 

oriT

 

Origin of transference region of RP4 plasmid (246 bp).

 

DNA sequence:

PshAI – – -CTTTTCCGCTGCATAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTG
CCAAAGGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGTGTTCCTTCTTC
ACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGTA – – – FseI

 

Primers

 
Since the three core sequences above (T0, T1 and oriT) are shared by all plasmid of the series, specific primer pairs (table below) were designed that hybridize these regions for amplification of any of the intervening regions.
 

Primer name Sequence (5´- 3´) Target sequence
PS1 AGGGCGGCGGATTTGTCC T1 terminator
PS2 GCGGCAACCGAGCGTTC T0 terminator
PS3 GAACGCTCGGTTGCCGC T0 terminator
PS4 CCAGCCTCGCAGAGCAGG oriT
PS5 CCCTGCTTCGGGGTCATT oriT
PS6 GGACAAATCCGCCGCCCT T1 terminator